Home Biology

Biology examples

Gene Expression Problem

Transcription The DNA sequence provided is: 5’ TACCGAATCCATGGCTCTTAGAGGTAGTCC 3’ Transcription of the complementary strand (3’ to 5’) will produce the mRNA strand (5’ to 3’): DNA: 3’ GGACTACCTCTAAGAGCCATGGATTCGGTA 5’ mRNA: 5’ CCUGAUGGAUCUCUCGGUACCUAAGCCAU 3’ Translation The mRNA sequence is translated into a polypeptide sequence using the codon table. mRNA: 5’ CCUGAUGGAUCUCUCGGUACCUAAGCCAU 3’ Codons: CCU GAU GGA...

The Fascinating World of Microbiology

Microbiology is the study of microscopic organisms. The discipline of microbiology is enormous and scintillating, revolutionizing concepts regarding the world around us. From single-celled bacteria that cover our bodies to intricate viruses that can apparently change the course of human history, the microbial world offers almost boundless opportunities for scientific discovery. This comparative analysis will...

Is It Necessary to Feed/Fertilize Plants

Feeding of Plants Technically, feeding plants and fertilizing plants do not mean the same thing. Fertilizing plants entails the application of micronutrients and macronutrients that provide plants with food. Normally, the terms feeding the plant and fertilizing the plant are used interchangeably. This is because fertilizers are used to enrich the soil by providing essential...

Lab Report: Photosynthesis

Abstract The purpose of this experiment was to determine the need for light in the production of starch in plants. The predictions were that light is one of the conditions that necessitate the process of photosynthesis and thus, of starch production, in the leaf of geranium. Two pots were filled with geraniums, one of which...

Microbial Journal Article Review

Background Michalik et al.’s (2021) paper grew from a long fascination with knowing what components of a bacterial genome are necessary and what the impact of eliminating non-essential components of the genome is on physiology, fitness, and biotechnology potential. Bacillus subtilis is a classic Gram-positive model organism for basic and biotechnology research. Reduced-genome strains of...

Get a custom essay tailored to your needs

350+ experts are ready to take on your assignment.

Hire expert

Human Microbiome and Health

The human microbiome refers to a significant number of microorganisms in the human body responsible for maintaining health and regulating many physiological processes. These microbiomes, especially gut microbiomes, are involved in digestion, nutrient absorption, defense, and producing valuable metabolites. Subsequently, the manipulation and regulation of the microbiome as a therapy and preventive measure of common...

Identical Twin Convicted Through DNA Differences: A Landmark Case in Forensic Science

DNA research has revolutionized the manner in which crimes are solved and investigated. Since the 1980s, forensic scientists have relied on DNA profiles to identify suspects, clear the innocent, and bring justice to cases that would otherwise not have been solved. Nonetheless, a significant problem with DNA analysis has always been the case of identical...

Mycobacterium Tuberculosi

Humans have been affected by Mycobacterium tuberculosis since time immemorial. This highly infectious pathogen is still a major public health problem across the globe, causing over 10 million new cases of active TB annually. It has virulence factors that enable it to withstand the host’s immune system, become air-borne, and cause complicated latent lung infections...

Measles (Rubeola) in Infants

Measles or rubeola is a powerfully contagious acute disease triggered by an RNA virus of the genus Morbillivirus of the family Paramyxoviridae, manifested through fever and a rash. The airborne transmission of measles is primarily achieved through breath droplets that move in short excursions and can also be spread via small aerosol droplets that persist...

The Role of Pollinators in Food Production

Food production is one of the most vital pillars of human existence, and on this basis, there is a fragile interconnectedness between plants, animals, and the environment. Pollinators are very crucial in this process, and the numerous contributors to the same process usually underestimate them. Pollinators are creatures, primarily insects, birds, and a few mammals,...

Can't find a sample that works for you?

Save hours on editing and get a custom essay from a field expert.

Order now
350+ writers

Study smart, stress less with experts

Delegate your essays to field writers and get the personalized help you need.

Delegate my paper
Reviews score