Problems
Transcription The DNA sequence provided is: 5’ TACCGAATCCATGGCTCTTAGAGGTAGTCC 3’ Transcription of the complementary strand (3’ to 5’) will produce the mRNA strand (5’ to 3’): DNA: 3’ GGACTACCTCTAAGAGCCATGGATTCGGTA 5’ mRNA: 5’ CCUGAUGGAUCUCUCGGUACCUAAGCCAU 3’ Translation The mRNA sequence is translated into a polypeptide sequence using the codon table. mRNA: 5’ CCUGAUGGAUCUCUCGGUACCUAAGCCAU 3’ Codons: CCU GAU GGA...
Question One Stock Valuation using Fama-French Three-Factor Model An analyst has modeled the stock of a company using the Fama-French three-factor model. The risk-free rate is 5%, the market return is 9%, the return on the SMB portfolio is 3.2%, and the return on the HML portfolio is 4.8%. If a = 0, b =...
Effects of Friction on Acceleration The following problems prove that friction, which usually works in the opposite direction to motion, affects acceleration. As per Newton’s second law of motion, friction cancels part of the force, leading to a smaller acceleration. Question 1: A locomotive train consists of two 8.00 × 105 kg engines and 45...
Delegate your essays to field writers and get the personalized help you need.
Delegate my paper
